5.5.1 What it does?
The all-in-one module is a wrapper script designed to streamline the execution of all four previously described modules in a single run, avoiding repeated input.
5.5.2 Example
nasap all --read1 ../data/test_r1.fq.gz --adapter1 TGGAATTCTCGGGTGCCAAGG --bowtie_index ../data/hg38_bowtie2_index/hg38_bowtie2_index --gtf ../data/Homo_sapiens.GRCh38.93.gtf --output_root ./tmp --tf_source ../data/Homo_sapiens.GRCh38_tf_target.txt --cores 12
Parameters
| parameter | description |
|---|---|
| --bowtie_index (Required) | bowtie2 index file. |
| --gtf (Required) | gtf file. |
| --read1 (Required) | Sample FASTQ(gz) file. |
| --read2 (Optional) | Mate pair end FASTQ(gz) file. |
| --adapter1 (Optional) | Adapter sequence. |
| --adapter2 (Optional) | Adapter sequence for read2. |
| --umi (Optional) | UMI location. |
| --cores (Optional) | Multiprocess num. |
| --tf_source (Required) | bowtie2 index file. |
| --tf_filter_nodes (Optional) | gtf file. |
| --enhancer_source (Optional) | Sample FASTQ(gz) file. |
| --enhancer_filter_nodes (Optional) | Mate pair end FASTQ(gz) file. |
| --output_root (Optional) | Output root directory. |